Prev. |  KEGG KO K02875 > 

RIKEN DNA Bank Human Resource - RPL14

Gene ID NCBI Gene 9045 |  KEGG hsa:9045
Gene Symbol RPL14
Protein Name ribosomal protein L14
Synonyms CAG-ISL-7|CTG-B33|L14|RL14|hRL14
Ortholog resources KEGG ortholog (KEGG orthology K02875) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011631 IRAK029B07 pCMV-SPORT6 BC019651 NM_003973 Full/var
HGX020099 IRAK050E03 pCMV-SPORT6 BC029036 NM_003973 Full/var
HGY082146 IRAL005G02 pOTB7 BC000606 NM_003973 Full/var
HGY085776 IRAL014H08 pOTB7 BC005134 NM_003973 Full/var
HGY090499 IRAL026E03 pOTB7 BC009294 NM_003973 Full/var
HGY097117 IRAL042N05 pOTB7 BC022805 NM_003973 Partial/var
HGY103575 IRAL058P15 pOTB7 BC071913 NM_003973 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100039 M01C050B15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100087 M01C050D15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100135 M01C050F15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100183 M01C050H15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100231 M01C050J15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100279 M01C050L15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100327 M01C050N15 pDONR221 MGC14-G08 BC000606 NM_003973  
HGE100375 M01C050P15 pDONR221 MGC14-G08 BC000606 NM_003973  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040979 ARe02H11 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTTCGTGGAGGTTGGCCGGGTG
HKR043256 ARe08C08 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR044100 ARe10E04 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR048932 ARe22F12 pKA1U5 NM_003973.3  
GCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTG
HKR051771 ARe29H03 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGAGTCTTACTGTTGCGGGCTCCGGGGCCGTCG
HKR055331 ARe38F11 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR056006 ARe40A06 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR062484 ARe56D12 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCNACATGGTGTTCACNCNCTTCGTGGAGGTTGGCCGGGCTG
HKR062850 ARe57C02 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR064075 ARe60D03 pKA1U5 NM_003973.3  
GGTCTTCTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTG
HKR068146 ARe70G02 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCNTTCGTGGAGGTTGGCCGGGTG
HKR068922 ARe72F02 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR073746 ARe84G02 pKA1U5 NM_003973.3  
GCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTG
HKR082053 ARf05C05 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR166155 ARi15G11 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR170505 ARi26E09 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR172171 ARi30H03 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR173226 ARi33B02 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR173234 ARi33B10 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR178058 ARi45C10 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR182971 ARi57H03 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR184006 ARi60A06 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR187369 ARi68H01 pGCAP10 NM_003973.3  
GCTTCTTCTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTT
HKR188032 ARi70B08 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR203267 ARiS008C19 pGCAP10 NM_003973.3  
GCTTCTTCCTTCTCNCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGC
HKR218301 ARiS045M13 pGCAP10 NM_003973.3  
GCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTG
HKR219842 ARiS049K02 pGCAP10 NM_003973.3  
GCCTTCTCNCCTAACCCTGCCAACATGGTGTTNNGGCNCTTCNTGGAGGTTGGCCGGGTG
HKR235370 ARiS088H02 pGCAP10 NM_003973.3  
GGCAGGGTTGGGCGGGTCTTCTTCCTTCTCGCCTAACGCTGCCAACATGGTGAGTCTTAC
HKR247442 ARiS118K02 pGCAP10 NM_003973.3  
GCTTCTCNTCTANCTCTGCCAACNTGGCTGTTCNGGNTCTTCNCGNAGGTTGGNCGGGTG
HKR264681 ARiS161L17 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR279473 ARiS198L09 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR324155 RBb10G11 pKA1U5 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR334059 RBb35C11 pGCAP1 NM_003973.3  
GTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGG
HKR338926 RBb47F06 pGCAP1 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR342907 RBb57E11 pGCAP1 NM_003973.3  
TCACTGCAGTTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGG
HKR344475 RBb61D03 pGCAP1 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR364431 RBd11B07 pGCAP10 NM_003973.3  
GCTTCTCTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGG
HKR367355 RBd18G11 pGCAP10 NM_003973.3  
GTTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGG
HKR369283 RBd23D11 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR370859 RBd27C11 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR372826 RBd32B02 pGCAP10 NM_003973.3  
GCTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGG
HKR375722 RBd39F02 pGCAP10 NM_003973.3  
GTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGG
HKR380012 RBd50A12 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR380152 RBd50G08 pGCAP10 NM_003973.3  
GTTCCTTCTCGCCTAACGCTGCCAACATGGTGAGTCTTACTGTTGCGGGCTCCGGGGCCG
HKR380176 RBd50H08 pGCAP10 NM_003973.3  
GTTCCTTCTCGCCTAACGCTGCCAACATGGTGAGTCTTACTGTTGCGGGCTCCGGGGCCG
HKR380574 RBd51H06 pGCAP10 NM_003973.3  
GCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTG
HKR385658 RBd64C10 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR389751 RBd74G07 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR398453 RBd96C05 pGCAP10 NM_003973.3  
GCTTCTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGC
HKR405505 RBdS013M17 pGCAP10 NM_003973.3  
GCTNNNNNCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR405753 RBdS014G09 pGCAP10 NM_003973.3  
GTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGG
HKR441702 RBdS104E06 pGCAP10 NM_003973.3  
GGTTCTTCTACACATGCGCAGGGTTGGGCGGGTCTTCTTCCTTCTCGCCTAACGCTGCCA
HKR444033 RBdS110B09 pGCAP10 NM_003973.3  
GCTTCTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGC
HKR444259 RBdS110K19 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR452910 RBdS132E14 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG
HKR452968 RBdS132G24 pGCAP10 NM_003973.3  
GCTCTTCTTCCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTG
HKR474994 RBdS187I02 pGCAP10 NM_003973.3  
TGCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTG
HKR475155 RBdS187O19 pGCAP10 NM_003973.3  
GCTTCTCGCCTAACGCTGCCAACATGGTGTTCAGGCGCTTCGTGGAGGTTGGCCGGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl