Prev. |  KEGG KO K02153 > 

RIKEN DNA Bank Human Resource - ATP6V0E1

Gene ID NCBI Gene 8992 |  KEGG hsa:8992
Gene Symbol ATP6V0E1
Protein Name ATPase H+ transporting V0 subunit e1
Synonyms ATP6H|ATP6V0E|M9.2|Vma21|Vma21p
Ortholog resources KEGG ortholog (KEGG orthology K02153) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062480 ARe56D08 pKA1U5 NM_003945.3  
GGACACTTCCTGGTGGGATCCGAGTGAGGCGACCGGTNNANGGGTTGGCGCTCAGGCGGC
HKR076554 ARe91G10 pKA1U5 NM_003945.3  
GCTGGTGGGATCCGAGTGAGGCGACGGGGTAGGGGTTGGCGCTCAGGCGGCGACCATGGC
HKR170503 ARi26E07 pGCAP10 NM_003945.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR170504 ARi26E08 pGCAP10 NM_003945.3  
GGGGATCCGAGTGAGGCGACGGGGTAGGGGTTGGCGCTCAGGCGGCGACCATGGCGTATC
HKR185297 ARi63E01 pGCAP10 NM_003945.3  
GGAGGCGACGGGGTAGGGGTTGGCGCTCAGGCGGCGACCATGGCGTATCACGGCCTCACT
HKR442179 RBdS105H11 pGCAP10 NM_003945.3  
GACTTCCTGGTGGGATCCGAGTGAGGCGACGGGGTAGGGGTTGGCGCTCAGGCGGCGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl