Prev. |  KEGG KO K11275 > 

RIKEN DNA Bank Human Resource - H1FX

Gene ID NCBI Gene 8971 |  KEGG hsa:8971
Gene Symbol H1FX
Protein Name H1 histone family member X
Synonyms H1.10|H1X
Ortholog resources KEGG ortholog (KEGG orthology K11275) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080429 IRAL001B05 pOTB7 BC000426 NM_006026 Full
HGY089463 IRAL023K23 pOTB7 BC010435 NM_006026 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000522 W01A001F02 pENTR-TOPO IRAL001B05 BC000426 NM_006026  
HGE000524 W01A001F04 pENTR-TOPO IRAL001B05 BC000426 NM_006026  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044146 ARe10G02 pKA1U5 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAAGTTCCAGAGGCGCCAGTTGGAAGCTGCGGCGGC
HKR044502 ARe11E06 pKA1U5 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGNTGGAAGCTGCGGCGGCG
HKR045635 ARe14B11 pKA1U5 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTTGGAAGCTGCGGCGGCG
HKR048408 ARe21A08 pKA1U5 NM_006026.2  
TAATGAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTTGGAAGCTGCGGC
HKR057230 ARe43B06 pKA1U5 NM_006026.2  
GAGAGCGCANCGCGCACGCCNAGNGAGTTCCAGACGCNCCANCTGGAAGCTGCGGCGGCG
HKR061774 ARe54H06 pKA1U5 NM_006026.2  
GCAGAAGTCGCANCGGCGCACGCCCAGTCGAGTTCCAGCAGGCGCCAGNTGCGAAGCTGC
HKR069727 ARe74F07 pKA1U5 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGNGCCAGNTGGAAGCTGCGGCGGCG
HKR174401 ARi36A01 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR175332 ARi38F12 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR180407 ARi51A07 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR186526 ARi66F06 pGCAP10 NM_006026.2  
TGAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCG
HKR186932 ARi67F12 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR332100 RBb30E04 pGCAP1 NM_006026.2  
GAGAGCGCAGCGCGCACNCCCAGCGAGTTCCAGAGGCGCCAGTTGGAAGCTGCGGCGGCG
HKR337352 RBb43G08 pGCAP1 NM_006026.2  
TGAGAGCGCAGCGCGCACNCCCAGCGAGTTCCAGAGGCGCCAGNTGGAAGCTGCGGCGG
HKR342858 RBb57C10 pGCAP1 NM_006026.2  
GAGAGCGCAGCGCGCACNCCCAGTCGAGTTTCCAGAGGCGCCAGTTGGAAGCTGCGGCGG
HKR344152 RBb60G08 pGCAP1 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR366151 RBd15G07 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR366553 RBd16G09 pGCAP10 NM_006026.2  
TGAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCG
HKR373280 RBd33D08 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR373375 RBd33H07 pGCAP10 NM_006026.2  
GTGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGC
HKR376875 RBd42D03 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAAAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR378128 RBd45F08 pGCAP10 NM_006026.2  
GAGACNNNNNNGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR405582 RBdS013P22 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACNCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR405824 RBdS014J08 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR441793 RBdS104I01 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR441806 RBdS104I14 pGCAP10 NM_006026.2  
GANAGNGNAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG
HKR474948 RBdS187G04 pGCAP10 NM_006026.2  
GAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl