Prev. |  KEGG KO K19929 > 

RIKEN DNA Bank Human Resource - CDK5R2

Gene ID NCBI Gene 8941 |  KEGG hsa:8941
Gene Symbol CDK5R2
Protein Name cyclin dependent kinase 5 regulatory subunit 2
Synonyms NCK5AI|P39|p39nck5ai
Ortholog resources KEGG ortholog (KEGG orthology K19929) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013143 IRAK032O07 pBluescriptR BC041771 NM_003936 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR337628 RBb44B04 pGCAP1 NM_003936.3  
TGAGTAGCAGCGGCGCCGCCCGCGGCTCCTGNTGGGGACTGGGCNCCGGCCCTGCTCTGC
HKR368860 RBd22C12 pGCAP10 NM_003936.3  
GAGCGGCNCCGCCCGCGGCTCCCGCTGGGNNNGGGCGCCGGCCCGCTCTGCANGANGGGC
HKR375249 RBd38C01 pGCAP10 NM_003936.3  
GGCGCGCCCGGGCCGGGGCTAGGCCCCCCACCGCCGGGTCCCCCGGGGCTGCAGAAGANT
HKR393778 RBd84H10 pGCAP10 NM_003936.3  
GGTCTCTTTCGCCTGCCTCCTCNGCCAAGGGCCGGAGGCCCGGCGGGCTGCCCGAGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl