Prev. |  KEGG KO K13210 > 

RIKEN DNA Bank Human Resource - FUBP3

Gene ID NCBI Gene 8939 |  KEGG hsa:8939
Gene Symbol FUBP3
Protein Name far upstream element binding protein 3
Synonyms FBP3
Ortholog resource in our bank

  FUBP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001643 IRAK004B19 pCMV-SPORT6 BC001325 XM_945906 Full/var
HGY088025 IRAL020B01 pOTB7 BC007874 XM_945904 Full
HGY097610 IRAL044A10 pOTB7 BC041566 XM_945907 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162906 ARi07E10 pGCAP10 NM_003934.1  
GGCGGGAGGCCGGACCGGGGAGCCGAGCGGCGGCGTCGGCGGCGTCGGCGGCGGCGGCGA
HKR181273 ARi53D01 pGCAP10 NM_003934.1  
GGCTGGAGGTCCGNCCCCGGAGTCGAGCGGCCNTGTCGGCCTACTCCGCGGTCGATTTCA
HKR408904 RBdS022E08 pGCAP10 NM_003934.1  
GAGCGGGAGGCCGGACCGGGGAGCCGAGCGGCGGCGTCGGCGGCGTCGGCGGCGGCGGCG
HKR432653 RBdS081K13 pGCAP10 NM_003934.1  
GCGGCTACGGGTCCCCAAGCGGAGCGGGAGGCCGGACCGGGGAGCCGAGCGGCGGCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl