Prev. |  KEGG KO K07916 > 

RIKEN DNA Bank Human Resource - RAB29

Gene ID NCBI Gene 8934 |  KEGG hsa:8934
Gene Symbol RAB29
Protein Name RAB29, member RAS oncogene family
Synonyms RAB7L|RAB7L1
Featured content Rab Family - human
Ortholog resource in our bank

  RAB29

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081722 IRAL004F02 pOTB7 BC002585 NM_003929 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044504 ARe11E08 pKA1U5 NM_003929.2  
GACGTGACGCTTGCGGAGGAAGGGGAGAGAGAGGCGCGCGGGAGGTCGTCTAGGGAATCG
HKR393677 RBd84D05 pGCAP10 NM_003929.2  
GCTGCACGTGACGCTTGCGGAGGAAGGGGAGAGAGAGGCGCGCGGGAGGTCGTCTAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl