DNA Bank Top |  KEGG KO K03155 > 

RIKEN DNA Bank Human Resource - TIMELESS

Gene ID NCBI Gene 8914 |  KEGG hsa:8914
Gene Symbol TIMELESS
Protein Name timeless circadian regulator
Synonyms FASPS4|TIM|TIM1|hTIM

Link

Ortholog resource in our bank

  TIMELESS


External database

human TIMELESS

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03872 SEREX clone NGO-St-142 (ID 1359) #1 SEREX clone NGO-St-142 (ID 1359) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005518 IRAK013N06 pCMV-SPORT6 BC031514 NM_003920 Full/var
HGX042957 IRAK107G13 pCMV-SPORT6 BC050557 NM_003920 Full/var
HGX033974 IRAK084P14 pCMV-SPORT6 BC039842 NM_003920 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095222 M01C038A22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095270 M01C038C22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095318 M01C038E22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095366 M01C038G22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095414 M01C038I22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095462 M01C038K22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095510 M01C038M22 pDONR221 MGC08-F11 BC050557 ENST00000229201  
HGE095558 M01C038O22 pDONR221 MGC08-F11 BC050557 ENST00000229201  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368884 RBd22D12 pGCAP10 NM_003920.2  
GGCCTCGCTCTTCGCGCagGcGGGGACCGGTCCAGCTGAGCCTGGTGgcGgAAagGcTGC
HKR442097 RBdS105E01 pGCAP10 NM_003920.2  
GGGGGACCGGTCCAGCTGAGCCTGGTGGCGGAAAGGCTGCGGCCCCGCGCCAGAGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl