Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP1M1

Gene ID (NCBI) 8907
Gene Symbol AP1M1
Protein Name adaptor-related protein complex 1, mu 1 subunit
Synonyms AP47|CLAPM2|CLTNM|MU-1A
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006082 IRAK015D10 pCMV-SPORT6 BC017469 NM_032493 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092022 M01C030A22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092070 M01C030C22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092118 M01C030E22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092166 M01C030G22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092214 M01C030I22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092262 M01C030K22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092310 M01C030M22 pDONR221 MGC04-F11 BC017469 NM_032493  
HGE092358 M01C030O22 pDONR221 MGC04-F11 BC017469 NM_032493  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276524 ARiS191F04 pGCAP10 NM_032493.2  
GAACGCCCAGCAGTCCCCACCGTCGCTGCCGCCGCCACCGCCCTCGGCCGCTGCCGAGGC
HKR394508 RBd86E12 pGCAP10 NM_032493.2  
GAAGTGGCCACGGGCGTAGCCCCCCGGGCGGCGGCACCAACAGCGGCGGCGGCATCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl