Prev. | 

RIKEN DNA Bank Human Resource - CPNE1

Gene ID NCBI Gene 8904 |  KEGG hsa:8904
Gene Symbol CPNE1
Protein Name copine 1
Synonyms COPN1|CPN1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082526 IRAL006F06 pOTB7 BC001142 NM_152931 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183769 ARi59H01 pGCAP10 NM_003915.4  
GGGCCATTTTGTGAAGCGGCGAAGGAGGTGGTGGCTGCGTTGGGCTCCGGGAAGCCGTTC
HKR398025 RBd95B01 pGCAP10 NM_003915.4  
GGCTGAGCGGGCCGACGGCCATTTTGTGAAGCGGCGAAGGAGGTGGTGGCTGCGTTGGGC
HKR405886 RBdS014L22 pGCAP10 NM_003915.4  
GGTGAAGCGGCGAAGGAGGTGGTGGCTGCGTTGGGCTCCGGGAAGCCGTTCGGGCTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl