Prev. |  KEGG KO K12873 > 

RIKEN DNA Bank Human Resource - BUD31

Gene ID NCBI Gene 8896 |  KEGG hsa:8896
Gene Symbol BUD31
Protein Name BUD31 homolog
Synonyms Cwc14|EDG-2|EDG2|G10|YCR063W|fSAP17
Ortholog resource in our bank

  BUD31

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097108 IRAL042M20 pOTB7 BC022821 NM_003910

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018963 W01A047G19 pENTR-TOPO IRAL042M20 BC022821 NM_003910  
HGE018993 W01A047I01 pENTR-TOPO IRAL042M20 BC022821 NM_003910  
HGE018999 W01A047I07 pENTR-TOPO IRAL042M20 BC022821 NM_003910  
HGE019005 W01A047I13 pENTR-TOPO IRAL042M20 BC022821 NM_003910  
HGE019007 W01A047I15 pENTR-TOPO IRAL042M20 BC022821 NM_003910  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064833 ARe62B09 pKA1U5 NM_003910.3  
GCTTAGAGATCGCCTGAAGAGCGGAAGCCTTCTGTCGAGAAGCAGCTACCCAAGCTCCAG
HKR366055 RBd15C07 pGCAP10 NM_003910.3  
GGGGCTCGACTTCTTCCTCCTGGGCCAGCCGCCGCCGCCGCTTCAGTGGCCGCAGTGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl