Prev. | 

RIKEN DNA Bank Human Resource - CPNE3

Gene ID NCBI Gene 8895 |  KEGG hsa:8895
Gene Symbol CPNE3
Protein Name copine 3
Synonyms CPN3|PRO1071
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY025554 IRAK063O18 pBluescriptR BC036242 NM_003909 Full/var
HGX056353 IRAK140O17 pCMV-SPORT6 BC066597 NM_003909 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072803 ARe82A03 pKA1U5 NM_003909.3  
GGCGGTCCCAGCGNTCGCTCCGGACGCTGCCAACCTGNTTCTCCACCGNTCGCTCGACTT
HKR222324 ARiS055N12 pGCAP10 NM_003909.3  
GGCGGTCCCAGCGTCGCTCCGGACGCTGCCAACCTGTTCTCCACCGTCGCTCGACTTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl