Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EIF2B5

Gene ID (NCBI) 8893
Gene Symbol EIF2B5
Protein Name eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa
Synonyms CACH|CLE|EIF-2B|EIF2Bepsilon|LVWM
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005602 IRAK014A02 pCMV-SPORT6 BC013590 NM_003907 Full/var
HGX046085 IRAK115D13 pCMV-SPORT6 BC053646 NM_003907 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE086046 M01C015B22 pDONR221 FLJ05-D11 AK091646 NM_003907
HGE086094 M01C015D22 pDONR221 FLJ05-D11 AK091646 NM_003907
HGE086142 M01C015F22 pDONR221 FLJ05-D11 AK091646 NM_003907
HGE086190 M01C015H22 pDONR221 FLJ05-D11 AK091646 NM_003907
HGE086238 M01C015J22 pDONR221 FLJ05-D11 AK091646 NM_003907
HGE086286 M01C015L22 pDONR221 FLJ05-D11 AK091646 NM_003907

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR363378 RBd08H10 pGCAP10 NM_003907.2
GGTGAGAGAAGAAGATGGCGGCCCCTGTAGTGGCGCCGCCTGGTGTGGTGGTTAGTCGGG
HKR336011 RBb40A11 pGCAP1 NM_003907.2
GGAAGAAGATGGCGGCCCCTGNTAGTGGCGCCGCCTGGTGTGGTGGTTAGTCGGGCTAAC
HKR344525 RBb61F05 pGCAP1 NM_003907.2
TGGGTGAGAGAAGAAGATGGCGGCCCCTGTAGTGGCGCCGCCTGGTGTGGTGGTTAGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl