Prev. |  KEGG KO K03240 > 

RIKEN DNA Bank Human Resource - EIF2B5

Gene ID NCBI Gene 8893 |  KEGG hsa:8893
Gene Symbol EIF2B5
Protein Name eukaryotic translation initiation factor 2B subunit epsilon
Synonyms CACH|CLE|EIF-2B|EIF2Bepsilon|LVWM
Ortholog resource in our bank

  EIF2B5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17724 pCOLA-3C-eIF2Be-eIF2Bg Bacterial expression vector of human eukaryotic translation initiation factor 2B subunit gamma (eIF2Bgamma) and human eukaryotic translation initiation factor 2B subunit epsilon (eIF2Bepsilon).

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005602 IRAK014A02 pCMV-SPORT6 BC013590 NM_003907 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE086046 M01C015B22 pDONR221 FLJ05-D11 AK091646 NM_003907  
HGE086094 M01C015D22 pDONR221 FLJ05-D11 AK091646 NM_003907  
HGE086142 M01C015F22 pDONR221 FLJ05-D11 AK091646 NM_003907  
HGE086190 M01C015H22 pDONR221 FLJ05-D11 AK091646 NM_003907  
HGE086238 M01C015J22 pDONR221 FLJ05-D11 AK091646 NM_003907  
HGE086286 M01C015L22 pDONR221 FLJ05-D11 AK091646 NM_003907  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336011 RBb40A11 pGCAP1 NM_003907.2  
GGAAGAAGATGGCGGCCCCTGNTAGTGGCGCCGCCTGGTGTGGTGGTTAGTCGGGCTAAC
HKR344525 RBb61F05 pGCAP1 NM_003907.2  
TGGGTGAGAGAAGAAGATGGCGGCCCCTGTAGTGGCGCCGCCTGGTGTGGTGGTTAGTCG
HKR363378 RBd08H10 pGCAP10 NM_003907.2  
GGTGAGAGAAGAAGATGGCGGCCCCTGTAGTGGCGCCGCCTGGTGTGGTGGTTAGTCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl