Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EIF2B2

Gene ID (NCBI) 8892
Gene Symbol EIF2B2
Protein Name eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
Synonyms EIF-2Bbeta|EIF2B
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080478 IRAL001D06 pOTB7 BC000494 NM_014239 Full/var
HGY083951 IRAL009O15 pOTB7 BC003165 NM_014239 Full/var
HGY090874 IRAL027D02 pOTB7 BC011750 NM_014239 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR056074 ARe40D02 pKA1U5 NM_014239.2
GAGGTGTGGATTCCGCCGGTGAAGGCTGAAGGCCGCTTACCTTAAAGATGCCGGGATCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl