Prev. |  KEGG KO K03754 > 

RIKEN DNA Bank Human Resource - EIF2B2

Gene ID NCBI Gene 8892 |  KEGG hsa:8892
Gene Symbol EIF2B2
Protein Name eukaryotic translation initiation factor 2B subunit beta
Synonyms EIF-2Bbeta|EIF2B
Ortholog resource in our bank

  EIF2B2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17723 pETDuet-eIF2Bd-eIF2Bb Bacterial expression vector of human eukaryotic translation initiation factor 2B subunit beta (eIF2Bbeta) and human eukaryotic translation initiation factor 2B subunit delta (eIF2Bdelta).
RDB18641 pETDuet-2B4-2B2_dE310K Bacterial expression vector of human eIF2Bdelta mutant (E310K) and human eIF2Bbeta.
RDB18642 pETDuet-2B4-2B2_dL314Q Bacterial expression vector of human eIF2Bdelta mutant (L314Q) and human eIF2Bbeta.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080478 IRAL001D06 pOTB7 BC000494 NM_014239 Full/var
HGY083951 IRAL009O15 pOTB7 BC003165 NM_014239 Full/var
HGY090874 IRAL027D02 pOTB7 BC011750 NM_014239 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056074 ARe40D02 pKA1U5 NM_014239.2  
GAGGTGTGGATTCCGCCGGTGAAGGCTGAAGGCCGCTTACCTTAAAGATGCCGGGATCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.01

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl