Prev. |  KEGG KO K03680 > 

RIKEN DNA Bank Human Resource - EIF2B4

Gene ID NCBI Gene 8890 |  KEGG hsa:8890
Gene Symbol EIF2B4
Protein Name eukaryotic translation initiation factor 2B subunit delta
Synonyms EIF-2B|EIF2B|EIF2Bdelta
Ortholog resource in our bank

  EIF2B4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17723 pETDuet-eIF2Bd-eIF2Bb Bacterial expression vector of human eukaryotic translation initiation factor 2B subunit beta (eIF2Bbeta) and human eukaryotic translation initiation factor 2B subunit delta (eIF2Bdelta).
RDB18641 pETDuet-2B4-2B2_dE310K Bacterial expression vector of human eIF2Bdelta mutant (E310K) and human eIF2Bbeta.
RDB18642 pETDuet-2B4-2B2_dL314Q Bacterial expression vector of human eIF2Bdelta mutant (L314Q) and human eIF2Bbeta.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083409 IRAL008I17 pOTB7 BC001870 NM_015636 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097616 M01C044A16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097664 M01C044C16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097712 M01C044E16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097760 M01C044G16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097808 M01C044I16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097856 M01C044K16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097904 M01C044M16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097952 M01C044O16 pDONR221 MGC11-F08 BC001870 NM_015636  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR024578 ARa61H10 pKA1U5 NM_015636.3  
GGGAGCCTAGGACTGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGGACTCGGGA
HKR392458 RBd81C10 pGCAP10 NM_015636.3  
GGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGGACTCGGGATCCGGGATGAAGG
HKR444317 RBdS110N05 pGCAP10 NM_015636.3  
GGGAGCCTAGGACTGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGGACTCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.05.01

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl