DNA Bank Top |  KEGG KO K03680 > 

RIKEN DNA Bank Human Resource - EIF2B4

Gene ID NCBI Gene 8890 |  KEGG hsa:8890
Gene Symbol EIF2B4
Protein Name eukaryotic translation initiation factor 2B subunit delta
Synonyms EIF-2B|EIF2B|EIF2Bdelta|VWM4

Link

Ortholog resource in our bank

  EIF2B4


External database

human EIF2B4

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18642 pETDuet-2B4-2B2_dL314Q Bacterial expression vector of human eIF2Bdelta mutant (L314Q) and human eIF2Bbeta.    
RDB18641 pETDuet-2B4-2B2_dE310K Bacterial expression vector of human eIF2Bdelta mutant (E310K) and human eIF2Bbeta.    
RDB17723 pETDuet-eIF2Bd-eIF2Bb Bacterial expression vector of human eukaryotic translation initiation factor 2B subunit beta (eIF2Bbeta) and human eukaryotic translation initiation factor 2B subunit delta (eIF2Bdelta).    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083409 IRAL008I17 pOTB7 BC001870 NM_015636 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097616 M01C044A16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097664 M01C044C16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097712 M01C044E16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097760 M01C044G16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097808 M01C044I16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097856 M01C044K16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097904 M01C044M16 pDONR221 MGC11-F08 BC001870 NM_015636  
HGE097952 M01C044O16 pDONR221 MGC11-F08 BC001870 NM_015636  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR024578 ARa61H10 pKA1U5 NM_015636.3  
GGGAGCCTAGGACTGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGGACTCGGGA
HKR392458 RBd81C10 pGCAP10 NM_015636.3  
GGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGGACTCGGGATCCGGGATGAAGG
HKR444317 RBdS110N05 pGCAP10 NM_015636.3  
GGGAGCCTAGGACTGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGGACTCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.12.13

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl