Prev. |  KEGG KO K21347 > 

RIKEN DNA Bank Human Resource - TAX1BP1

Gene ID NCBI Gene 8887 |  KEGG hsa:8887
Gene Symbol TAX1BP1
Protein Name Tax1 binding protein 1
Synonyms CALCOCO3|T6BP|TXBP151
Ortholog resource in our bank

  TAX1BP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008441 W01A021B17 pENTR-TOPO IRAK098J06 BC050358 NM_006024  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066578 ARe66H10 pKA1U5 NM_006024.5 done
GGGTCTTTGGGGGTAGGCGGTAGTGGCGGAAGAGGTTCGGCGGCTGATGGCGGATCAGGA
HKR186154 ARi65G10 pGCAP10 NM_006024.5  
GAGTGGCGGAAGAGGTTCGGCGGCTGATGGCGGATCANGATCGGAAGCCTGCGTAACTTT
HKR420526 RBdS051F06 pGCAP10 NM_006024.5  
GGGGGGTAGGCGGTAGTGGCGGAAGAGGTTCGGCGGCTGATGGCGGATCAGGATCGGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl