Prev. |  KEGG KO K13179 > 

RIKEN DNA Bank Human Resource - DDX18

Gene ID NCBI Gene 8886 |  KEGG hsa:8886
Gene Symbol DDX18
Protein Name DEAD-box helicase 18
Synonyms Has1|MrDb
Ortholog resource in our bank

  DDX18

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001449 IRAK003K09 pCMV-SPORT6 BC003360 NM_006773 Full/var
HGX001857 IRAK004K17 pCMV-SPORT6 BC001238 NM_006773 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015042 W01A037K02 pENTR-TOPO flj0015a21 AK091227 NM_006773  
HGE015044 W01A037K04 pENTR-TOPO flj0015a21 AK091227 NM_006773  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162145 ARi05G01 pGCAP10 NM_006773.3  
GAGCCTGAGAACTGAGTAGCTGTACTGTGTGGCGCCTTATTCTAGGCACTTGTTGGGCAG
HKR341284 RBb53D12 pGCAP1 NM_006773.3  
GACGTGCGGCCGGANNGGAAGTAACGTCAGCCNGAGANCCCTTNNNNGGNCCTGTGTGGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl