Prev. |  KEGG KO K14386 > 

RIKEN DNA Bank Human Resource - SLC5A6

Gene ID NCBI Gene 8884 |  KEGG hsa:8884
Gene Symbol SLC5A6
Protein Name solute carrier family 5 member 6
Synonyms SMVT
Ortholog resource in our bank

  SLC5A6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083156 IRAL007O20 pOTB7 BC012806 NM_021095 Full/var
HGY093210 IRAL033A10 pOTB7 BC015631 NM_021095 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380406 RBd51A06 pGCAP10 NM_021095.1  
GGGTCCAGTCGCCCTGGGGCTGCTTGGGGGCTTTTCCTGCTCGTGGAGCTCTGCGCTGGT
HKR408857 RBdS022C09 pGCAP10 NM_021095.1  
GCTCTTCCCCGGGCGTGGCCTAAGCGGCCCGGTCCAGTCGCCCTGGGGCTGCTTGGGGGC
HKR461611 RBdS154A11 pGCAP10 NM_021095.1  
GGGGCTCCCGGCCAGGGCTCTCGGCCGGGCTCTGGCTACCCACGTGTGGAGACCGGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl