Prev. |  KEGG KO K04532 > 

RIKEN DNA Bank Human Resource - NAE1

Gene ID NCBI Gene 8883 |  KEGG hsa:8883
Gene Symbol NAE1
Protein Name NEDD8 activating enzyme E1 subunit 1
Synonyms A-116A10.1|APPBP1|HPP1|ula-1
Ortholog resources KEGG ortholog (KEGG orthology K04532) in the DNA Bank
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080769 IRAL001P09 pOTB7 BC000480 NM_003905 Full
HGY084095 IRAL010D23 pOTB7 BC013301 NM_003905 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082504 ARf06E08 pKA1U5 NM_003905.3  
GGCTGTTTTCCGCGCGGCAGGCGCGGCCATGGCGCAGCTGGGAAAGCTGCTCAAGGAGCA
HKR324476 RBb11D04 pKA1U5 NM_003905.3  
GGGTGGCGGCGCTCCGCAGGGGCTCGGCTGTTTTCCGCGCGGCAGGCGCGGCCATGGCGC
HKR332177 RBb30H09 pGCAP1 NM_003905.3  
GCTGCGCGCTTGTGGAGCTGGTGGCGGCGCTCCGCAGGGGCTCGGCTGTTTTCCGCGCGG
HKR343653 RBb59C05 pGCAP1 NM_003905.3  
GGTGGAGCTGGTGGCGGCGCTCCGCAGGGGCTCGGCTGTTTTCCGCGCGGCAGGCGCGGC
HKR377625 RBd44B01 pGCAP10 NM_003905.3  
GAGTGCCCCTGCGCGCTTGTGGAGCTGGTGGCGGCGCTCCGCAGGGGCTCGGCTGNTTTC
HKR386576 RBd66H08 pGCAP10 NM_003905.3  
GAGNGCGCCTGCGCGCTTGTGGAGCTGGTGGCGGCGCTCCGCAGGGGCTCGGCTGTTTTC
HKR389708 RBd74E12 pGCAP10 NM_003905.3  
GGCTCCGCAGGGGCTCGGCTGTTTTCCGCGCGGCAGGCGCGGCCATGGCGCAGCTGGGAA
HKR433548 RBdS083O12 pGCAP10 NM_003905.3  
GGCTTGTGGAGCTGGTGGCGGCGCTCCGCAGGGGCTCGGCTGTTTTCCGCGCGGCAGGCG
HKR442345 RBdS105O09 pGCAP10 NM_003905.3  
GGCGCCTGCGCGCTTGTGGAGCTGGTGGCGGCGCTCCGCAGGGGCTCGGCTGTTTTCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl