Prev. |  KEGG KO K03353 > 

RIKEN DNA Bank Human Resource - CDC16

Gene ID NCBI Gene 8881 |  KEGG hsa:8881
Gene Symbol CDC16
Protein Name cell division cycle 16
Synonyms ANAPC6|APC6|CDC16Hs|CUT9
Ortholog resource in our bank

  CDC16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005695 IRAK014D23 pCMV-SPORT6 BC010875 NM_003903 Full/var
HGY095803 IRAL039I11 pOTB7 BC017244 NM_003903 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326976 RBb17H08 pKA1U5 NM_003903.2  
GGCCTGCCTGGAGCGGAAGAGACTGGGCAGATGCACGGGGCCTGGGGTGGGGGGTGCGGG
HKR398408 RBd96A08 pGCAP10 NM_003903.2  
GGCACGGGGCCTGGGTGGGGGGTGCGGGTGTGGGTGGTTATGTGGTCCCATCTATAAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl