Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SQSTM1

Gene ID (NCBI) 8878
Gene Symbol SQSTM1
Protein Name sequestosome 1
Synonyms A170|OSIL|PDB3|ZIP3|p60|p62|p62B
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08189 pBK-CMVp62Flag Expression vector of human p62/SQSTM1 cDNA, FLAG-tagged
RDB08190 pSRalpha3HA-p62 Expression vector of human p62/SQSTM1 cDNA, HA-tagged
RDB08191 pSRalpha3HA-p62-4A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08192 pSRalpha3HA-p62-3A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08193 pSRalpha3HA-p62-7A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08194 pSRalpha3HA-p62-385 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08195 pSRalpha3HA-p62-344 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08196 pSRalpha3HA-p62-334 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08197 pSRalpha3HA-p62-3N Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08198 pSRalpha3HA-p62-H174A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08199 pSRalpha3HA-p62-E177Q Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08200 pSRalpha3HA-p62-S180A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08201 pSRalpha3HA-p62-H181A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08202 pSRalpha3HA-p62-S182A Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08203 pcDNA3HA-p62 Expression vector of human p62/SQSTM1 cDNA, HA-tagged
RDB08204 pcDNA3HA-p62-delta257 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08205 pcDNA3HA-p62-delta163 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08206 pcDNA3HA-p62-delta172 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged
RDB08207 pcDNA3HA-p62-delta182 Expression vector of human p62/SQSTM1 mutant cDNA, HA-tagged

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001564 IRAK003P04 pCMV-SPORT6 BC000951 NM_003900 Partial
HGY083415 IRAL008I23 pOTB7 BC001874 NM_003900 Partial/var
HGY083774 IRAL009H06 pOTB7 BC003139 NM_003900 Full
HGY088241 IRAL020K01 pOTB7 BC017222 NM_003900 Full
HGY095982 IRAL039P22 pOTB7 BC019111 NM_003900 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE001868 W01A004L04 pENTR-TOPO IRAL020K01 BC017222 NM_003900

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR161682 ARi04D10 pGCAP10 NM_003900.4
GACGGACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGC
HKR162148 ARi05G04 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR167284 ARi18D12 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR050880 ARe27D08 pKA1U5 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR175345 ARi38G01 pGCAP10 NM_003900.4
GGGCGCCGCGAGGGGGTGGGGTGGGGGCCGGCGGCCGGGATCCCGATCGGCTCCCGCAGC
HKR056956 ARe42G12 pKA1U5 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR058970 ARe47H02 pKA1U5 NM_003900.4
GGACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGNTGAAGGCCT
HKR177780 ARi44H12 pGCAP10 NM_003900.4
GACGGACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGC
HKR179628 ARi49B04 pGCAP10 NM_003900.4
GGACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTA
HKR060150 ARe50G06 pKA1U5 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGNTGAAGGCCTA
HKR181676 ARi54D04 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR185249 ARi63C01 pGCAP10 NM_003900.4
ACGGCCGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCC
HKR186927 ARi67F07 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR078150 ARe95G06 pKA1U5 NM_003900.4
TTTGGACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGC
HKR209525 ARiS023N13 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR234991 ARiS087H23 pGCAP10 NM_003900.4
HKR235273 ARiS088D01 pGCAP10 NM_003900.4
TGACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTA
HKR248866 ARiS122C18 pGCAP10 NM_003900.4
GGGCGCCGCGAGGGGGTGGGGTGGGGGCCGGCGGCCGGGATCCCGATCGGCTCCCGCAGC
HKR264567 ARiS161G23 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR277615 ARiS194A15 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR398883 RBd97D11 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCAGCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC
HKR428243 RBdS070K03 pGCAP10 NM_003900.4
GACGGCCCGTTTTCCGCCANCTCGCCGCTCGCTATGGCGTCGCTCACCGTGAAGGCCTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl