Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SPHK1

Gene ID (NCBI) 8877
Gene Symbol SPHK1
Protein Name sphingosine kinase 1
Synonyms SPHK
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Sphingolipid signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX025856 IRAK064K16 pCMV-SPORT6 BC030553 NM_182965
HGY085733 IRAL014F13 pOTB7 BC004112 NM_182965 Partial
HGY089297 IRAL023E01 pOTB7 BC009419 NM_182965
HGY089916 IRAL024N04 pOTB7 BC008040 NM_182965 Partial/var
HGY093873 IRAL034L09 pOTB7 BC014439 NM_182965 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE020162 W01A050G18 pENTR-TOPO IRAK064K16 BC030553 NM_182965  
HGE020164 W01A050G20 pENTR-TOPO IRAK064K16 BC030553 NM_182965  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175753 ARi39G09 pGCAP10 NM_182965.2  
GGGGGATTGTAGGCTTAGTCACACGGCGGGGGCGCCCTCGGAGGCACCGGACCTCAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl