Prev. | 

RIKEN DNA Bank Human Resource - CDC123

Gene ID NCBI Gene 8872 |  KEGG hsa:8872
Gene Symbol CDC123
Protein Name cell division cycle 123
Synonyms C10orf7|D123
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17728 pEBMulti-Neo-human-CDC123 Expression vector of human cell division cycle 123 (CDC123).

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083208 IRAL008A08 pOTB7 BC001600 NM_006023 Full/var
HGY088541 IRAL021F21 pDNR-LIB BC009598 NM_006023 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052154 ARe30G10 pKA1U5 NM_006023.2  
GAGAGTTCCGGGAGGGTGCAGGCAGGAGAGGGAAAGGCAGCAGCGGCGGCAGCTGGAGGA
HKR161329 ARi03F09 pGCAP10 NM_006023.2  
GGGGAAAGGCAGCAGCGGCGGCAGCTGGAGGATGAAGAAGGAGCATGTGCTTCACTGCCA
HKR376459 RBd41C11 pGCAP10 NM_006023.2  
GGGGAGGGTGCAGGCAGGAGAGGGAAAGGCAGCAGCGGCGGCAGCTGGAGGATGAAGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl