Prev. | 

RIKEN DNA Bank Human Resource - IER3

Gene ID NCBI Gene 8870 |  KEGG hsa:8870
Gene Symbol IER3
Protein Name immediate early response 3
Synonyms DIF-2|DIF2|GLY96|IEX-1|IEX-1L|IEX1|PRG1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001602 IRAK004A02 pCMV-SPORT6 BC000844 NM_003897 Full
HGY087361 IRAL018G17 pOTB7 BC005080 NM_003897 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052902 ARe32E06 pKA1U5 NM_003897.3  
ACTTGGCCTTACACTCCGCTCGGCTCACCATGTGTCACTCTCGCAGCTGCCACCCGACCA
HKR062974 ARe57H06 pKA1U5 NM_003897.3  
GACTTGGCCTTACACTCCGCTCGGCTCACCATGCTGTNACATCTCGCAGCTGCCACCCGA
HKR249038 ARiS122J22 pGCAP10 NM_003897.3  
GACTTGGCCTTACACTCCGCTCGGCTCACCATGTGTCACTCTCGCAGCTGCCACCCGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl