Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALKBH1

Gene ID (NCBI) 8846
Gene Symbol ALKBH1
Protein Name alkB, alkylation repair homolog 1 (E. coli)
Synonyms ABH|ABH1|ALKBH|alkB|hABH
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006173 IRAK015H05 pCMV-SPORT6 BC015024 NM_001039506 Partial
HGX019981 IRAK049P21 pCMV-SPORT6 BC025787 NM_006020 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE092847 M01C032B23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE092895 M01C032D23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE092943 M01C032F23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE092991 M01C032H23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE093039 M01C032J23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE093087 M01C032L23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE093135 M01C032N23 pDONR221 MGC05-G12 BC025787 ENST00000321428
HGE093183 M01C032P23 pDONR221 MGC05-G12 BC025787 ENST00000321428

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR331201 RBb28A01 pGCAP1 NM_006020.2
GAGAGGGTATAGGCCGCGAGATGGGGAAGATGGCAGCGGCCGTGGGCTCTGTGGCGACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl