Prev. |  KEGG KO K10765 > 

RIKEN DNA Bank Human Resource - ALKBH1

Gene ID NCBI Gene 8846 |  KEGG hsa:8846
Gene Symbol ALKBH1
Protein Name alkB homolog 1, histone H2A dioxygenase
Synonyms ABH|ABH1|ALKBH|alkB|hABH
Ortholog resource in our bank

  ALKBH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006173 IRAK015H05 pCMV-SPORT6 BC015024 NM_001039506 Partial
HGX019981 IRAK049P21 pCMV-SPORT6 BC025787 NM_006020 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092847 M01C032B23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE092895 M01C032D23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE092943 M01C032F23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE092991 M01C032H23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE093039 M01C032J23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE093087 M01C032L23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE093135 M01C032N23 pDONR221 MGC05-G12 BC025787 ENST00000321428  
HGE093183 M01C032P23 pDONR221 MGC05-G12 BC025787 ENST00000321428  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331201 RBb28A01 pGCAP1 NM_006020.2  
GAGAGGGTATAGGCCGCGAGATGGGGAAGATGGCAGCGGCCGTGGGCTCTGTGGCGACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl