DNA Bank Top |  KEGG KO K04724 > 

RIKEN DNA Bank Human Resource - CFLAR

Gene ID NCBI Gene 8837 |  KEGG hsa:8837
Gene Symbol CFLAR
Protein Name CASP8 and FADD like apoptosis regulator
Synonyms CASH|CASP8AP1|CLARP|Casper|FLAME|FLAME-1|FLAME1|FLIP|I-FLICE|MRIT|c-FLIP|c-FLIPL|c-FLIPR|c-FLIPS|cFLIP
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human

Link

Ortholog resource in our bank

  CFLAR

External database

human CFLAR

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB02199 AxCAhFLIP Recombinant adenovirus expressing human FLIP regulated by CAG promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007254 W01A018C06 pENTR-TOPO IRAL008I12 BC001602 NM_003879 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061206 ARe53A06 pKA1U5 NM_003879.3  
GAGAGGTTCTCGGACGCCCTCCGGCGAAGCCACCTGTTGATGCTTTTGACTTTCTGTCCT
HKR168830 ARi22B06 pGCAP10 NM_003879.3  
GGCCTCCATCTTGGGTGCGCCTTCCCGGCGTCTAGGGGAGCGAAGGCTGAGGTGGCAGCG
HKR187704 ARi69E08 pGCAP10 NM_003879.3  
TTGATTTTCAGCCGGTGGGTGGCGGGGATTAGGCGTGAAGCGGTTCAGCAGGCAGAGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl