Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CFLAR

Gene ID (NCBI) 8837
Gene Symbol CFLAR
Protein Name CASP8 and FADD like apoptosis regulator
Synonyms CASH|CASP8AP1|CLARP|Casper|FLAME|FLAME-1|FLAME1|FLIP|I-FLICE|MRIT|c-FLIP|c-FLIPL|c-FLIPR|c-FLIPS
Databases KEGG hsa:8837 |  NCBI Gene 8837
Featured content NF-kappa B signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04724)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02199 AxCAhFLIP Recombinant adenovirus expressing human FLIP regulated by CAG promoter

RDB_org_170226.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007254 W01A018C06 pENTR-TOPO IRAL008I12 BC001602 NM_003879 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168830 ARi22B06 pGCAP10 NM_003879.3  
GGCCTCCATCTTGGGTGCGCCTTCCCGGCGTCTAGGGGAGCGAAGGCTGAGGTGGCAGCG
HKR061206 ARe53A06 pKA1U5 NM_003879.3  
GAGAGGTTCTCGGACGCCCTCCGGCGAAGCCACCTGTTGATGCTTTTGACTTTCTGTCCT
HKR187704 ARi69E08 pGCAP10 NM_003879.3  
TTGATTTTCAGCCGGTGGGTGGCGGGGATTAGGCGTGAAGCGGTTCAGCAGGCAGAGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl