RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CFLAR

Gene ID	NCBI Gene 8837 \| KEGG hsa:8837
Gene Symbol	CFLAR
Protein Name	CASP8 and FADD like apoptosis regulator
Synonyms	CASH\|CASP8AP1\|CLARP\|Casper\|FLAME\|FLAME-1\|FLAME1\|FLIP\|I-FLICE\|MRIT\|c-FLIP\|c-FLIPL\|c-FLIPR\|c-FLIPS\|cFLIP
Featured content	NF-kappa B signaling pathway (human)
Featured content	Apoptosis - human

Ortholog resource in our bank

  CFLAR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB02199	AxCAhFLIP	Recombinant adenovirus expressing human FLIP regulated by CAG promoter

webcatalog20220516.tab

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number	Clone name	Vector	Constructed from⁽¹⁾		Refered mRNA	Status
Catalog number	Clone name	Vector	Clone ID	Sequence (DDBJ)	Refered mRNA	Status
HGE007254	W01A018C06	pENTR-TOPO	IRAL008I12	BC001602	NM_003879

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR061206	ARe53A06	pKA1U5	NM_003879.3
HKR061206	GAGAGGTTCTCGGACGCCCTCCGGCGAAGCCACCTGTTGATGCTTTTGACTTTCTGTCCT
HKR168830	ARi22B06	pGCAP10	NM_003879.3
HKR168830	GGCCTCCATCTTGGGTGCGCCTTCCCGGCGTCTAGGGGAGCGAAGGCTGAGGTGGCAGCG
HKR187704	ARi69E08	pGCAP10	NM_003879.3
HKR187704	TTGATTTTCAGCCGGTGGGTGGCGGGGATTAGGCGTGAAGCGGTTCAGCAGGCAGAGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl