Prev. |  KEGG KO K01307 > 

RIKEN DNA Bank Human Resource - GGH

Gene ID NCBI Gene 8836 |  KEGG hsa:8836
Gene Symbol GGH
Protein Name gamma-glutamyl hydrolase
Synonyms GH
Ortholog resource in our bank

  GGH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010539 IRAK026F19 pCMV-SPORT6 BC025025 NM_003878 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041355 ARe03G11 pKA1U5 NM_003878.2  
GGCTTTTGAAAGGCGGCGGGAGGCGGCGAGCGCCATGGCCAGTCCGGGCTGCCTGCTGTG
HKR050031 ARe25B07 pKA1U5 NM_003878.2  
GAGAGCTTTTGAAAGGCGGCGGGAGGCGGCGAGCGCCATGGCCAGTCCGGGCTGCCTGCT
HKR187251 ARi68C03 pGCAP10 NM_003878.2  
GGCAGAGCTTTTGAAAGGCGGCGGGAGGCGGCGAGCGCCATGGCCAGTCCGGGCTGCCTG
HKR203433 ARiS008J17 pGCAP10 NM_003878.2  
GGCGCCATGGCCAGTCCGGGCTGCCTGCTGTGCGTGCTGGGCCTGCTACTCTGCGGGGCG
HKR203457 ARiS008K17 pGCAP10 NM_003878.2  
GGAAAAGGCGGCGGGAGGCGGCGAGCGCCATGGCCAGTCCGGGCTGCCTGCTGTGCGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl