Prev. |  KEGG KO K01951 > 

RIKEN DNA Bank Human Resource - GMPS

Gene ID NCBI Gene 8833 |  KEGG hsa:8833
Gene Symbol GMPS
Protein Name guanine monophosphate synthase
Synonyms GATD7
Ortholog resources KEGG ortholog (KEGG orthology K01951) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03858 SEREX clone NGO-St-126 (ID 1337) #1 SEREX clone NGO-St-126 (ID 1337) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091982 IRAL029P22 pOTB7 BC012178 NM_003875 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100418 M01C051A18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100466 M01C051C18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100514 M01C051E18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100562 M01C051G18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100610 M01C051I18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100658 M01C051K18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100706 M01C051M18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100754 M01C051O18 pDONR221 MGC15-B09 BC012178 NM_003875  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072428 ARe81B04 pKA1U5 NM_003875.2  
GGCGCGCTGCTGGTCTTCTCTCCCGCGGCGCTGGGGCCCGCGCTCCGCTGCTGTTGCTCC
HKR377705 RBd44E09 pGCAP10 NM_003875.2  
GCTCTCCCGCGGCGCTGGGGCCCGCGCTCCGCTGCTGTTGCTCCATTCGGCGCTTTTCTG
HKR393775 RBd84H07 pGCAP10 NM_003875.2  
GAGCGTGCGCGCTGCTGGTCTTCTCTCCCGCGGCGCTGGGGCCCGCGCTCCGCTGCTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl