DNA Bank Top |  KEGG KO K01951 > 

RIKEN DNA Bank Human Resource - GMPS

Gene ID NCBI Gene 8833 |  KEGG hsa:8833
Gene Symbol GMPS
Protein Name guanine monophosphate synthase
Synonyms GATD7

Link

Ortholog resource in our bank

  GMPS

External database

human GMPS

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03858 SEREX clone NGO-St-126 (ID 1337) #1 SEREX clone NGO-St-126 (ID 1337) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091982 IRAL029P22 pOTB7 BC012178 NM_003875 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100418 M01C051A18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100466 M01C051C18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100514 M01C051E18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100562 M01C051G18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100610 M01C051I18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100658 M01C051K18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100706 M01C051M18 pDONR221 MGC15-B09 BC012178 NM_003875  
HGE100754 M01C051O18 pDONR221 MGC15-B09 BC012178 NM_003875  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072428 ARe81B04 pKA1U5 NM_003875.2  
GGCGCGCTGCTGGTCTTCTCTCCCGCGGCGCTGGGGCCCGCGCTCCGCTGCTGTTGCTCC
HKR377705 RBd44E09 pGCAP10 NM_003875.2  
GCTCTCCCGCGGCGCTGGGGCCCGCGCTCCGCTGCTGTTGCTCCATTCGGCGCTTTTCTG
HKR393775 RBd84H07 pGCAP10 NM_003875.2  
GAGCGTGCGCGCTGCTGGTCTTCTCTCCCGCGGCGCTGGGGCCCGCGCTCCGCTGCTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl