Prev. |  KEGG KO K19202 > 

RIKEN DNA Bank Human Resource - SAP30

Gene ID NCBI Gene 8819 |  KEGG hsa:8819
Gene Symbol SAP30
Protein Name Sin3A associated protein 30
Synonyms -
Ortholog resource in our bank

  SAP30

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087696 IRAL019D24 pDNR-LIB BC016757 NM_003864 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE047382 W01A118H14 pENTR-TOPO IRAL019D24 BC016757 NM_003864  
HGE047384 W01A118H16 pENTR-TOPO IRAL019D24 BC016757 NM_003864  
HGE047386 W01A118H18 pENTR-TOPO IRAL019D24 BC016757 NM_003864  
HGE047388 W01A118H20 pENTR-TOPO IRAL019D24 BC016757 NM_003864  
HGE047390 W01A118H22 pENTR-TOPO IRAL019D24 BC016757 NM_003864  
HGE047392 W01A118H24 pENTR-TOPO IRAL019D24 BC016757 NM_003864  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057725 ARe44F05 pKA1U5 NM_003864.3  
GAGTGAGCGGGGTCCCCGCTCCAGGAGACGCTCCANTTATGCGTCCCGGCCCTCAGCACT
HKR264784 ARiS161P24 pGCAP10 NM_003864.3  
TGGACNNTNNNCGGNGTCCCCNNTNNNGGAGACGCTCGAGTCTGCGTCCCGGCCCTCAGC
HKR368898 RBd22E02 pGCAP10 NM_003864.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl