Prev. |  KEGG KO K08881 > 

RIKEN DNA Bank Human Resource - TRIM24

Gene ID NCBI Gene 8805 |  KEGG hsa:8805
Gene Symbol TRIM24
Protein Name tripartite motif containing 24
Synonyms PTC6|RNF82|TF1A|TIF1|TIF1A|TIF1ALPHA|hTIF1
Ortholog resource in our bank

  TRIM24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013638 IRAK034B14 pBluescriptR BC028689 NM_015905 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203340 ARiS008F20 pGCAP10 NM_003852.3  
GGTCCACCGAGCGGCCTCTGAGGAGCAGCCGCAGGAGGAGGAGGAGGTCGTCGGGGGCGG
HKR433536 RBdS083N24 pGCAP10 NM_003852.3  
GGCCTCTGAGGAGCAGCCGCAGGAGGAGGAGGAGGTCGTCGGGGGCGGCGGGCGGAGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl