Prev. | 

RIKEN DNA Bank Human Resource - CREG1

Gene ID NCBI Gene 8804 |  KEGG hsa:8804
Gene Symbol CREG1
Protein Name cellular repressor of E1A stimulated genes 1
Synonyms CREG
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001411 IRAK003I19 pCMV-SPORT6 BC006786 NM_003851 Full
HGX005174 IRAK012P14 pCMV-SPORT6 BC008628 NM_003851 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058081 ARe45D09 pKA1U5 NM_003851.2  
GACTCTTCCTGGAGACACCGCCATGGCCGGGCTATCCCGCGGGTCCGCGCGCGCACTGCT
HKR067775 ARe69H07 pKA1U5 NM_003851.2  
GGACTCTTCCTGGAGACACCGCCATGGCCGGGCTATCCCGCGGGTCCGCGCGCGCACTGC
HKR203338 ARiS008F18 pGCAP10 NM_003851.2  
GGGGACTCTTCCTGGAGACACCGCCATGGCCGGGCTATCCCGCGGGTCCGCGCGCGCACT
HKR247543 ARiS118O07 pGCAP10 NM_003851.2  
GCTGGAGACACCGCCATGGCCGGGCTATCCCGCGGGTCCGCGCGCGCACTGCTCGCCGCC
HKR394880 RBd87D08 pGCAP10 NM_003851.2  
GACTCTTCCTGGAGACACCGCCATGGCCGGGCTATCCCGCGGGTCCGCGCGCGCACTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl