Prev. |  KEGG KO K01900 > 

RIKEN DNA Bank Human Resource - SUCLG2

Gene ID NCBI Gene 8801 |  KEGG hsa:8801
Gene Symbol SUCLG2
Protein Name succinate-CoA ligase GDP-forming subunit beta
Synonyms G-SCS|GBETA|GTPSCS
Ortholog resource in our bank

  SUCLG2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017052 IRAK042K12 pCMV-SPORT6 BC019868 NM_003848 Partial
HGY029447 IRAK073K07 pBluescriptR BC035149 NM_003848 Partial
HGX037501 IRAK093M13 pCMV-SPORT6 BC047024 NM_003848
HGY067158 IRAK167O22 pBluescriptR BC068602 NM_003848 Full/var
HGY087141 IRAL017O05 pOTB7 BC007716 NM_003848 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094844 M01C037B20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE094892 M01C037D20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE094940 M01C037F20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE094988 M01C037H20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE095036 M01C037J20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE095084 M01C037L20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE095132 M01C037N20 pDONR221 MGC08-D10 BC047024 NM_003848  
HGE095180 M01C037P20 pDONR221 MGC08-D10 BC047024 NM_003848  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162956 ARi07G12 pGCAP10 NM_003848.2  
GTTTCCTGTTTAAGATGGCGTCCCCCGTAGCAGCGCAGGCCGGGAAGCTTCTGCGAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl