Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TNFRSF10B

Gene ID (NCBI) 8795
Gene Symbol TNFRSF10B
Protein Name TNF receptor superfamily member 10b
Synonyms CD262|DR5|KILLER|KILLER/DR5|TRAIL-R2|TRAILR2|TRICK2|TRICK2A|TRICK2B|TRICKB|ZTNFR9
Databases KEGG hsa:8795 |  NCBI Gene 8795
Featured content Apoptosis - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04722)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05082 pAxCALNLhTRAILR4(forward) Shuttle vector to generate rAd expressing human TNFRSF10B
RDB05083 pAxCALNLhTRAILR4(reverse) Shuttle vector to generate rAd expressing human TNFRSF10B
RDB07380 pGL4-phTNFRSF10B Promoter collection, Human TNFRSF10B promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001608 IRAK004A08 pCMV-SPORT6 BC001281 NM_003842 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022373 W01A055P13 pENTR-TOPO IRAK004A08 BC001281 NM_003842  
HGE022375 W01A055P15 pENTR-TOPO IRAK004A08 BC001281 NM_003842  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059651 ARe49C03 pKA1U5 NM_147187.2  
TGGACACATAAATCAGCACGCGGCCGGAGAACCCCGCAATCTTTGCGCCCACAAAATACA
HKR247355 ARiS118G11 pGCAP10 NM_147187.2  
GAGCCTGGANCNTAAATCNNCNCGCNGCCGGAGAACCCCGCAATCTTTGCGCCCACAAAA
HKR430230 RBdS075J14 pGCAP10 NM_147187.2  
GACAGCCGCGCCGCCCCAAGTCAGCCTGGACACATAAATCAGCACGCGGCCGGAGAACCC
HKR444062 RBdS110C14 pGCAP10 NM_147187.2  
TGACACATAAATCAGCACGCGGCCGGAGAACCCCGCAATCTCTGCGCCCACAAAATACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl