Prev. |  KEGG KO K08508 > 

RIKEN DNA Bank Human Resource - SNAP23

Gene ID NCBI Gene 8773 |  KEGG hsa:8773
Gene Symbol SNAP23
Protein Name synaptosome associated protein 23
Synonyms HsT17016|SNAP-23|SNAP23A|SNAP23B
Ortholog resource in our bank

  SNAP23

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001551 IRAK003O15 pCMV-SPORT6 BC000148 NM_003825 Full
HGX001964 IRAK004P04 pCMV-SPORT6 BC003686 NM_003825 Full
HGY095322 IRAL038F02 pDNR-LIB BC022890 NM_003825 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234848 ARiS087B24 pGCAP10 NM_003825.2  
GGAGTTGCCGCCGGAGAGGAGTGGCCTCGCCCGCTTGAGTTTTGATTCATCATGGATAAT
HKR430192 RBdS075H24 pGCAP10 NM_003825.2  
GGCAGGCGCGACTAGGGTGCAGCGCCAGGTCCGGTGTTGGGGTGTCCGAGTTGCCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl