DNA Bank Top |  KEGG KO K02373 > 

RIKEN DNA Bank Human Resource - FADD

Gene ID NCBI Gene 8772 |  KEGG hsa:8772
Gene Symbol FADD
Protein Name Fas associated via death domain
Synonyms GIG3|IMD90|MORT1
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  FADD


External database

human FADD

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04709 pAxCALNLhFADD(reverse) Shuttle vector to generate rAd expressing human FADD    
RDB04703 pAxCALNLhFADD(forward) Shuttle vector to generate rAd expressing human FADD    
RDB04175 pAxCALNLhFADD (reverse) Shuttle vector to generate rAd harboring human FADD    
RDB03610 pAxCALNLhFADD (forward) Shuttle vector to generate rAd harboring human FADD (forward)    
RDB02007 pAxCAhFADD Shuttle vector to generate rAd expressing human FADD    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080607 IRAL001I15 pOTB7 BC000334 NM_003824 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024758 W01A061O22 pENTR-TOPO IRAL001I15 BC000334 NM_003824  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046035 ARe15B11 pKA1U5 NM_003824.3  
GGCTAGGGACGCATGCGCGGGTCCCTTAGTTTTCGCGAGATAACGGTCGAAAACGCGCTC
HKR260359 ARiS150O23 pGCAP10 NM_003824.3  
GGCCGCTGGGCAAGCGGCGAGACCTGGCCAGGGCCAGCGAGCCGAGGACAGAGGGCGCGC
HKR325684 RBb14D12 pKA1U5 NM_003824.3  
GAGTGAATCAGGCACCGGAGTGCAGGTTCGGGGGTGGAATCCTTGGGCCGCTGGGCAAGC
HKR332129 RBb30F09 pGCAP1 NM_003824.3  
GGAGTTTGAAGAAGGCTCTTACAGCATGGCCGCCGGTACTGCAGCTGCCTTAGCGTTTTT
HKR430147 RBdS075G03 pGCAP10 NM_003824.3  
GGCCCGTCCGCGGCGCCGCCAGCCAGGGCGGAAACGGCTGCGGCTTCGCTAGGGACGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl