Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CD164

Gene ID (NCBI) 8763
Gene Symbol CD164
Protein Name CD164 molecule, sialomucin
Synonyms MGC-24|MUC-24|endolyn
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005255 IRAK013C07 pCMV-SPORT6 BC011522 NM_006016
HGY029158 IRAK072O22 pBluescriptR BC040317 NM_006016 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045732 ARe14F12 pKA1U5 NM_006016.4  
GGCCGCAGGGGCATTGAGGGGTTGACTGAGCGTTGCNAGCCTTAGCTTTCTCCCGAACGC
HKR166854 ARi17C06 pGCAP10 NM_006016.4  
GGGCGGCGCCGCAGGGGATTGAGGGGTTGACTGAGCGTTGCGAGCCTTAGCTTTCTCCCG
HKR187207 ARi68A07 pGCAP10 NM_006016.4  
GGCCGCAGGGGATTGAGGGGTTGACTGAGCGTTGCGAGCCTTAGCTTTCTCCCGAACGCC
HKR276691 ARiS191M03 pGCAP10 NM_006016.4  
GAGTCTCGGAGGCGGCGCCGCAGGGGATTGAGGGGTTGACTGAGCGTTGCGAGCCTTAGC
HKR276760 ARiS191O24 pGCAP10 NM_006016.4  
CGGCCGGCCGATGGTAGTCTCGGAGGCGGCGCCGCAGGGGATTGAGGGGTTGACTGAGCG
HKR385732 RBd64F12 pGCAP10 NM_006016.4  
TAGCTTTCTCCCGAACGCGCNCGCTGAGGACACGATGCCGCGGNTCTCCCGCTCACTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl