Prev. |  KEGG KO K02832 > 

RIKEN DNA Bank Human Resource - CRADD

Gene ID NCBI Gene 8738 |  KEGG hsa:8738
Gene Symbol CRADD
Protein Name CASP2 and RIPK1 domain containing adaptor with death domain
Synonyms MRT34|RAIDD
Ortholog resources KEGG ortholog (KEGG orthology K02832) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008280 IRAK020L16 pCMV-SPORT6 BC017042 NM_003805 Full
HGY030237 IRAK075J21 pBluescriptR BC037905 NM_003805 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR079751 ARe99G07 pKA1U5 NM_003805.3  
TGGGAACAAAGATGGTGCTTATGGGGCAGGTTCCCTAACAGTCAGGATTCCGGTTGCAGT
HKR380852 RBd52C04 pGCAP10 NM_003805.3  
GATTAACAAAGATGGTGCTTATGGGGCAGGTTCCCTAACAGTCAGGATTCCGGTTGCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl