Prev. |  KEGG KO K05289 > 

RIKEN DNA Bank Human Resource - GPAA1

Gene ID NCBI Gene 8733 |  KEGG hsa:8733
Gene Symbol GPAA1
Protein Name glycosylphosphatidylinositol anchor attachment 1
Synonyms GAA1|hGAA1
Ortholog resources KEGG ortholog (KEGG orthology K05289) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082807 IRAL007A07 pOTB7 BC004129 NM_003801 Full
HGY083920 IRAL009N08 pOTB7 BC003171 NM_003801 Full
HGY086843 IRAL017B19 pOTB7 BC006383 NM_003801 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059703 ARe49E07 pKA1U5 NM_003801.3  
GCCGGGTTCTGACAGGAGCAGCCTGTGGGCACCGCGGCGGTAGTTGGAGGCGGGAGAGGG
HKR062897 ARe57E01 pKA1U5 NM_003801.3  
ACCGGAAGTGCGGGCGAGCGCGGGTCCCCGGNCCTTACAGGNAGCNGCCTGTGGGCNCCG
HKR075708 ARe89E12 pKA1U5 NM_003801.3  
GGAGCGCGGGTCCCCGGGATCTGACAGGAGCAGCCTGTTGGGCACCGCGGCGGTAGTTGG
HKR372530 RBd31F10 pGCAP10 NM_003801.3  
GCTCTGGGACCGGAAGTGCGGGCGAGCGCGGGTCCCCGGGTCTGACAGGAGCAGCCTGTG
HKR393301 RBd83E05 pGCAP10 NM_003801.3  
GGGGCACCGCGGCGGTAGTTGGAGGCGGGAGAGGGTCCGTAGCCGCGCCGCCCTGCCCCG
HKR453035 RBdS132J19 pGCAP10 NM_003801.3  
GGTCTCTGGGACCGGAAGTGCGGGCGAGCGCGGGTCCCCGGGTCTGACAGGAGCANCCTG
HKR474832 RBdS187B08 pGCAP10 NM_003801.3  
TTATCAGGCCCAGGCTTAGGGCTCGGGTCCGGCGTCCCGATGCAGGACTCCGGGTTTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl