Prev. | 

RIKEN DNA Bank Human Resource - CTNNAL1

Gene ID NCBI Gene 8727 |  KEGG hsa:8727
Gene Symbol CTNNAL1
Protein Name catenin alpha like 1
Synonyms ACRP|CLLP|alpha-CATU
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042077 ARe05D05 pKA1U5 NM_003798.2  
GGACTGGCGGCAGGCTCGCCGCGGCGCGGAGTCCCGGCTGCGGGATAGACCGAGGGCCAT
HKR056450 ARe41C02 pKA1U5 NM_003798.2  
GGGGCTGACTGGCGGCAGGCTCGCCGCGGCGCGGAGTCCCGGCTGCGGGATAGACCGAGG
HKR432446 RBdS081B22 pGCAP10 NM_003798.2  
GGAGTGTCCTGTCGCCGCCGCCTCGGGCGGGTGGGCTGACTGGCGGCAGGCTCGCCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl