Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SNX3

Gene ID (NCBI) 8724
Gene Symbol SNX3
Protein Name sorting nexin 3
Synonyms Grd19|MCOPS8|SDP3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008163 IRAK020G19 pCMV-SPORT6 BC016863 NM_152828 Full
HGX009008 IRAK022I16 pCMV-SPORT6 BC015179 NM_003795 Full
HGY088673 IRAL021L09 pDNR-LIB BC008444 NM_003795 Full
HGY092532 IRAL031F12 pDNR-LIB BC014580 NM_003795 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169675 ARi24D03 pGCAP10 NM_003795.4  
GAGCAGCGGCGGCGGCGGCGGCTGAACGCGGAGGGGGCGGAGGGAGCCCGCGGCGGCGGC
HKR059683 ARe49D11 pKA1U5 NM_003795.4  
GCTCTTCGCGACCGCTGCGCGCGAGCCCCGNTGCTCCNNACGGCGGGCAGCAGCGGCGGC
HKR180008 ARi50A08 pGCAP10 NM_003795.4  
CTCTTCTTCGCGACCGCTGCGCGCGAGCCCCGTGTCCCCACGGCGGGCAGCAGCGGCGGC
HKR068828 ARe72B04 pKA1U5 NM_003795.4  
GGCGCGAGCCCCGNTGTCCCCACGGCGGGCAGCAGCGGCGGCGGCGGCGGCTGAACGCGG
HKR222192 ARiS055H24 pGCAP10 NM_003795.4  
GGNGNGTCCCCACGGCGGGCAGCAGCGGCGGCGGCGGCGGCTGAACGCGGAGGGGGCGGA
HKR247468 ARiS118L04 pGCAP10 NM_003795.4  
GCNTNCCNACCNCTGNNNGCGNNCCCCGTGTCCCCACGGCGGGCAGCANCGGCGGGGGCG
HKR249114 ARiS122N02 pGCAP10 NM_003795.4  
GGCGCGAGCCCCGTGTCCCCACGGCGGGCAGCAGCGGCGGCGGCGGCGGCTGAACGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl