Prev. |  KEGG KO K01373 > 

RIKEN DNA Bank Human Resource - CTSF

Gene ID NCBI Gene 8722 |  KEGG hsa:8722
Gene Symbol CTSF
Protein Name cathepsin F
Synonyms CATSF|CLN13
Featured content Lysosome (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  CTSF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018869 IRAK047C21 pBluescriptR BC036451 NM_003793 Full
HGY090897 IRAL027E01 pOTB7 BC011682 NM_003793 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052530 ARe31F10 pKA1U5 NM_003793.3  
GATTGGTCGGCGTGCCGTCGCCCCGCTGGAGGGAGGACTCAGGCCCCGCTGGCCGCGGGC
HKR063260 ARe58C12 pKA1U5 NM_003793.3  
GGGAGGGAGGACTCAGGCCCCGCTGGCCGCGGGCTCGGTACCCGGTGGGTCGGTGGAGCG
HKR077675 ARe94D03 pKA1U5 NM_003793.3  
GGCTGGCCGCGGGCTCGGTACCCGGTGGGTCGGTGGAGCGTCTGTTGGGTCCGGGCCGCC
HKR248948 ARiS122G04 pGCAP10 NM_003793.3  
GGGAGGGAGGACTCAGGCCCCGCTGGCCGCGGGCTCGGTACCCGGTGGGTCGGTGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl