Prev. |  KEGG KO K00719 > 

RIKEN DNA Bank Human Resource - B3GALNT1

Gene ID NCBI Gene 8706 |  KEGG hsa:8706
Gene Symbol B3GALNT1
Protein Name beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Synonyms B3GALT3|GLCT3|GLOB|Gb4Cer|P|P1|beta3Gal-T3|galT3
Ortholog resources KEGG ortholog (KEGG orthology K00719) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036268 IRAK090L04 pBluescript BC047618 NM_033169 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014749 W01A036O13 pENTR-TOPO IRAK090L04 BC047618 NM_033169  
HGE041037 W01A102J21 pENTR-TOPO IRAK090L04 BC047618 NM_033169  
HGE041039 W01A102J23 pENTR-TOPO IRAK090L04 BC047618 NM_033169  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173204 ARi33A04 pGCAP10 NM_003781.3  
GCTGCGCGCGCCCGGCCGTGCGTGCGGATGCGGGGAGGCTGCGTGTGTGCGCAGGGAGAG
HKR174049 ARi35C01 pGCAP10 NM_003781.3  
GGGCCACCTTCCCGCTTCCGAGCTGGGTGCGCGCCGAGCACAGGAGATTGCCTGCGTTTA
HKR332052 RBb30C04 pGCAP1 NM_003781.3  
GGGGAGGCTGCGTGTGTGCGCAGGGAGAGAACGCCGGCCACCTTCCCGCTTCCGAGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl