Prev. |  KEGG KO K07968 > 

RIKEN DNA Bank Human Resource - B4GALT3

Gene ID NCBI Gene 8703 |  KEGG hsa:8703
Gene Symbol B4GALT3
Protein Name beta-1,4-galactosyltransferase 3
Synonyms beta4Gal-T3
Ortholog resources KEGG ortholog (KEGG orthology K07968) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082510 IRAL006E14 pOTB7 BC000276 NM_003779 Full
HGY087430 IRAL018J14 pOTB7 BC006099 NM_003779 Full
HGY090536 IRAL026F16 pOTB7 BC009985 NM_003779 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE031053 W01A077K13 pENTR-TOPO IRAL006E14 BC000276 NM_003779 done
HGE031057 W01A077K17 pENTR-TOPO IRAL006E14 BC000276 NM_003779  
HGE031059 W01A077K19 pENTR-TOPO IRAL006E14 BC000276 NM_003779  
HGE031061 W01A077K21 pENTR-TOPO IRAL006E14 BC000276 NM_003779  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362504 RBd06E08 pGCAP10 NM_003779.2  
GGCTTCCAAGATGGCGGCAGCGATGCCTGCCCGGCTGTTGGGGTGGCGGTGACGACAGGC
HKR444340 RBdS110O04 pGCAP10 NM_003779.2  
GGCTTCCAAGATGGCGGCAGCGATGCCTGCCCGGCTGTTGGGGTGGCGGTGACGACAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl