Prev. |  KEGG KO K07969 > 

RIKEN DNA Bank Human Resource - B4GALT4

Gene ID NCBI Gene 8702 |  KEGG hsa:8702
Gene Symbol B4GALT4
Protein Name beta-1,4-galactosyltransferase 4
Synonyms B4Gal-T4|beta4Gal-T4
Ortholog resources KEGG ortholog (KEGG orthology K07969) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX054118 IRAK135E22 pCMV-SPORT6 BC062618 NM_212543 Full/var
HGY084431 IRAL011B07 pOTB7 BC004523 NM_212543 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006051 W01A015C03 pENTR-TOPO IRAK135E22 BC062618 NM_212543  
HGE006053 W01A015C05 pENTR-TOPO IRAK135E22 BC062618 NM_212543  
HGE006055 W01A015C07 pENTR-TOPO IRAK135E22 BC062618 NM_212543  
HGE006061 W01A015C13 pENTR-TOPO IRAL011B07 BC004523 NM_212543 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR381773 RBd54H05 pGCAP10 NM_212543.1  
TGAGTGCTAGCTCGCCGCGGCCGCCTCCGGGGACCACCTGGCTTCATGTGTGGATTTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl