Prev. |  KEGG KO K11155 > 

RIKEN DNA Bank Human Resource - DGAT1

Gene ID NCBI Gene 8694 |  KEGG hsa:8694
Gene Symbol DGAT1
Protein Name diacylglycerol O-acyltransferase 1
Synonyms ARAT|ARGP1|DGAT|DIAR7
Ortholog resource in our bank

  DGAT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086279 IRAL015L15 pOTB7 BC006263 NM_012079 Partial/var
HGY092050 IRAL030C02 pOTB7 BC023565 NM_012079 Full/var
HGY093771 IRAL034H03 pOTB7 BC015762 NM_012079 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052033 ARe30B09 pKA1U5 NM_012079.4  
GCTCTCCAGGCCCCGCCTCAGGTCGGCCGCGGACTACAAATGGACGAGAGAGGCGGCCGT
HKR406351 RBdS015O15 pGCAP10 NM_012079.4  
GGCTACGAACCCGGCGGGCCCACGCTTGGCTGCGGCCGGGTGCGGGCTGAGGCCATGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl