Prev. |  KEGG KO K08334 > 

RIKEN DNA Bank Human Resource - BECN1

Gene ID NCBI Gene 8678 |  KEGG hsa:8678
Gene Symbol BECN1
Protein Name beclin 1
Synonyms ATG6|VPS30|beclin1
Featured content Autophagy (human)
Featured content Mitophagy - human
Ortholog resource in our bank

  BECN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001415 IRAK003I23 pCMV-SPORT6 BC010276 NM_003766

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186859 ARi67C11 pGCAP10 NM_003766.3  
GGGCGGCTACCGGGAAGTCGCTGAAGACAGAGCGATGGTAGTTCTGGAGGCCTCGCTCCG
HKR321227 RBb03B03 pKA1U5 NM_003766.3  
GGGCGGCTACCGGGAAGTCGCTGAAGACAGAGCGATGGTAGTTCTGGAGGCCTCGCTCCG
HKR367628 RBd19B04 pGCAP10 NM_003766.3  
GCTCGGGCGGAAGTTTTCCGGCGGCTACCGGGAAGTCGCTGAAGACAGAGCGATGGTAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl