Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALDH4A1

Gene ID (NCBI) 8659
Gene Symbol ALDH4A1
Protein Name aldehyde dehydrogenase 4 family, member A1
Synonyms ALDH4|P5CD|P5CDh
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY088983 IRAL022H15 pOTB7 BC007581 NM_170726 Full/var
HGY093236 IRAL033B12 pOTB7 BC023600 NM_170726 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR161723 ARi04F03 pGCAP10 NM_003748.2
GTTCGGGTTCCCTTGTCCTGTGTTGTGTAATGCCCCCGTTATGGCACTAGAAATATTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl