Prev. |  KEGG KO K00294 > 

RIKEN DNA Bank Human Resource - ALDH4A1

Gene ID NCBI Gene 8659 |  KEGG hsa:8659
Gene Symbol ALDH4A1
Protein Name aldehyde dehydrogenase 4 family member A1
Synonyms ALDH4|P5CD|P5CDh
Ortholog resources KEGG ortholog (KEGG orthology K00294) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY093236 IRAL033B12 pOTB7 BC023600 NM_170726 Full
HGY088983 IRAL022H15 pOTB7 BC007581 NM_170726 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161723 ARi04F03 pGCAP10 NM_003748.2  
GTTCGGGTTCCCTTGTCCTGTGTTGTGTAATGCCCCCGTTATGGCACTAGAAATATTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl