Prev. |  KEGG KO K06057 > 

RIKEN DNA Bank Human Resource - NUMB

Gene ID NCBI Gene 8650 |  KEGG hsa:8650
Gene Symbol NUMB
Protein Name NUMB endocytic adaptor protein
Synonyms C14orf41|S171|c14_5527
Featured content Notch signaling pathway (human)
Ortholog resource in our bank

  NUMB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066942 IRAK167F22 pBluescriptR BC068476 NM_001005745 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041504 W01A103M16 pENTR-TOPO IRAK167F22 BC068476 NM_001005745  
HGE041510 W01A103M22 pENTR-TOPO IRAK167F22 BC068476 NM_001005745  
HGE041542 W01A103O06 pENTR-TOPO IRAK167F22 BC068476 NM_001005745  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066881 ARe67D09 pKA1U5 NM_003744.5  
GATGGGGGAGGTGGTGGCGCTTGGTGGCCACTGGCGGCCGAGGTAGAGGCAGTGGCGCTT
HKR182902 ARi57E06 pGCAP10 NM_003744.5  
GACTGGCGGCCGAGGTAGAGGCAGTGGCGCTTGAGTTGGTCGGGGGCAGCGGCAGATTTG
HKR391379 RBd78H11 pGCAP10 NM_003744.5  
GGGCGCTTGAGTTGGTCGGGGGCAGCGGCAGATTTGAGGCTTAAGCAACTTCTTCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl