Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUMB

Gene ID (NCBI) 8650
Gene Symbol NUMB
Protein Name numb homolog (Drosophila)
Synonyms C14orf41|S171|c14_5527
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Notch signaling pathway (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY066942 IRAK167F22 pBluescriptR BC068476 NM_001005745 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE041504 W01A103M16 pENTR-TOPO IRAK167F22 BC068476 NM_001005745
HGE041510 W01A103M22 pENTR-TOPO IRAK167F22 BC068476 NM_001005745
HGE041542 W01A103O06 pENTR-TOPO IRAK167F22 BC068476 NM_001005745

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR182902 ARi57E06 pGCAP10 NM_003744.5
GACTGGCGGCCGAGGTAGAGGCAGTGGCGCTTGAGTTGGTCGGGGGCAGCGGCAGATTTG
HKR066881 ARe67D09 pKA1U5 NM_003744.5
GATGGGGGAGGTGGTGGCGCTTGGTGGCCACTGGCGGCCGAGGTAGAGGCAGTGGCGCTT
HKR391379 RBd78H11 pGCAP10 NM_003744.5
GGGCGCTTGAGTTGGTCGGGGGCAGCGGCAGATTTGAGGCTTAAGCAACTTCTTCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl