Prev. |  KEGG KO K04370 > 

RIKEN DNA Bank Human Resource - LAMTOR3

Gene ID NCBI Gene 8649 |  KEGG hsa:8649
Gene Symbol LAMTOR3
Protein Name late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Synonyms MAP2K1IP1|MAPBP|MAPKSP1|MP1|PRO0633|Ragulator3
Ortholog resource in our bank

  LAMTOR3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095178 IRAL037P18 pDNR-LIB BC026245 NM_021970 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044460 ARe11C12 pKA1U5 NM_021970.3  
GGCAGACGAGGTCATGAATCATGTGACGGTGGCTTGNGGAGGAACCTGTCTTTAAAGCTG
HKR208217 ARiS020J01 pGCAP10 NM_021970.3  
GGCAGACGAGGTCATGAATCATGTGACGGTGGCTTGAGGAGGAACCTGTCTTTAAAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl