Prev. |  KEGG KO K16780 > 

RIKEN DNA Bank Human Resource - SSNA1

Gene ID NCBI Gene 8636 |  KEGG hsa:8636
Gene Symbol SSNA1
Protein Name SS nuclear autoantigen 1
Synonyms N14|NA-14|NA14
Ortholog resource in our bank

  SSNA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001620 IRAK004A20 pCMV-SPORT6 BC000864 NM_003731 Full/var
HGY085616 IRAL014A16 pOTB7 BC004118 NM_003731 Partial/var
HGY089829 IRAL024J13 pOTB7 BC015827 NM_003731 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045749 W01A114G05 pENTR-TOPO IRAK004A20 BC000864 NM_003731  
HGE045751 W01A114G07 pENTR-TOPO IRAK004A20 BC000864 NM_003731  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325725 RBb14F05 pKA1U5 NM_003731.2  
GAGGCGCGGACAGCGCTGCTTCCGCGGCGGTTGGGGTGGTGGGGCCCCGGGCGGCGTTGA
HKR405699 RBdS014E03 pGCAP10 NM_003731.2  
GAGCGCTGCTTCCGCGGCGGTTGGGGTGGTGGGGCCCCGGGCGGCGTTGACCATGACCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl