Prev. |  KEGG KO K08856 > 

RIKEN DNA Bank Human Resource - STK16

Gene ID NCBI Gene 8576 |  KEGG hsa:8576
Gene Symbol STK16
Protein Name serine/threonine kinase 16
Synonyms KRCT|MPSK|PKL12|PSK|TSF1|hPSK
Ortholog resource in our bank

  STK16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046171 IRAK115H03 pCMV-SPORT6 BC053998 NM_003691 Full
HGY081974 IRAL004P14 pOTB7 BC002618 NM_003691 Full/var
HGY089750 IRAL024G06 pOTB7 BC007381

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100016 M01C050A16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100064 M01C050C16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100112 M01C050E16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100160 M01C050G16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100208 M01C050I16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100256 M01C050K16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100304 M01C050M16 pDONR221 MGC14-F08 BC002618 NM_003691  
HGE100352 M01C050O16 pDONR221 MGC14-F08 BC002618 NM_003691  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038762 W01A096P02 pENTR-TOPO IRAL004P14 BC002618 NM_003691  
HGE038766 W01A096P06 pENTR-TOPO IRAL004P14 BC002618 NM_003691  
HGE048063 W01A120C15 pENTR-TOPO IRAL004P14 BC002618 NM_003691  
HGE048065 W01A120C17 pENTR-TOPO IRAL004P14 BC002618 NM_003691  
HGE048069 W01A120C21 pENTR-TOPO IRAL004P14 BC002618 NM_003691  
HGE048071 W01A120C23 pENTR-TOPO IRAL004P14 BC002618 NM_003691  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222010 ARiS055A10 pGCAP10 NM_003691.2  
GGTCGGTGGCGCTTCTCTCTGGCCCGAGCCAGCATGATCCGCTGGGCCCCCAGCGCATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl